Volume 8, Issue 2 e11321
Primer Note
Open Access

Development and characterization of novel SSR markers in the endangered endemic species Ferula sadleriana

Tamás Malkócs

Tamás Malkócs

Department of Botany, University of Debrecen, Debrecen, Hungary

Search for more papers by this author
Levente Laczkó

Levente Laczkó

Department of Botany, University of Debrecen, Debrecen, Hungary

Search for more papers by this author
Judit Bereczki

Judit Bereczki

Department of Evolutionary Zoology and Human Biology, University of Debrecen, Debrecen, Hungary

Search for more papers by this author
Emese Meglécz

Emese Meglécz

Aix-Marseille University, Avignon University, CNRS, IRD, IMBE, Marseille, France

Search for more papers by this author
Péter Szövényi

Péter Szövényi

Institute of Systematic and Evolutionary Botany, University of Zurich, Zurich, Switzerland

Search for more papers by this author
Gábor Sramkó

Corresponding Author

Gábor Sramkó

Department of Botany, University of Debrecen, Debrecen, Hungary

MTA-DE “Lendület” Evolutionary Phylogenomics Research Group, Debrecen, Hungary

Author for correspondence: [email protected]Search for more papers by this author
First published: 11 February 2020
Citations: 3

Abstract

Premise

Ferula sadleriana (Apiaceae) is a polycarpic, perennial herb with a very limited range and small populations. It is listed as “endangered” on the IUCN Red List of Threatened Species. Microsatellite markers can contribute to conservation efforts by allowing the study of the genetic structure of its shrinking populations.

Methods and Results

We used a microsatellite-enriched library combined with an Illumina sequencing approach to develop simple sequence repeat markers in our target species. Out of 44 tested primer pairs, 22 provided specific products, and 13 showed heterologous amplification in the target species. Cross-species amplification was achieved at 20 and 19 loci in two congeneric species, F. soongarica and F. tatarica, respectively.

Conclusions

The primers described here are the first tools that enable the population genetic characterization of F. sadleriana. Our results suggest a wider applicability in the genus Ferula.

Ferula L. is a genus of the Apiaceae family containing approximately 170 species with a geographic range extending from northern Africa to Central Asia (Pimenov and Leonov, 1993). It includes many species used in traditional medicine and numerous species that are endemic, especially in the Central Asian region (Kurzyna-Młynik et al., 2008). Ferula sadleriana Ledeb. is an iteroparous perennial herb with a range confined to the Carpathian Basin; it is assumed to be an interglacial relict with special biogeographical importance in the region (Lendvay and Kalapos, 2014). Despite its uniqueness, nothing is known about its phylogenetic placement as it has not been included in the latest comprehensive phylogeny of the genus (Panahi et al., 2018). The species is restricted to a mosaic habitat of rocky, dry grasslands, steppe slopes, and Pannonian karst white oak low woods (Kalapos and Lendvay, 2009). Only eight populations are known, centered in the hilly regions of northern Hungary and southern Slovakia with a satellite occurrence in Transylvania (central Romania). Population sizes range from less than 50 to 5000 individuals (Kalapos and Lendvay, 2009). Due to the small population sizes and the restricted distribution of the species, it is strictly protected in all three countries of its occurrence (Lendvay and Kalapos, 2014). It is classified as “endangered” in the IUCN Red List of Threatened Species (Király et al., 2011) and is included in the Annex II and IV of the Habitats Directive of the European Union (Council of the European Communities, 1992).

To facilitate the conservation efforts focusing on this unique species, we developed 13 polymorphic simple sequence repeat (SSR) markers that enable the study of the conservation genetics of F. sadleriana. We tested cross-amplification efficacy in two species (F. soongarica Pall. ex Schult. and F. tatarica Fisch. ex Spreng.) of the Eurasian steppe zone that form a monophyletic group with our target species within the genus (G. Sramkó, unpublished data). We are convinced that the markers described here will be useful in population genetic studies of this large genus.

METHODS AND RESULTS

Genomic DNA was extracted from populations of F. sadleriana and putative relatives (Appendix 1) following a modified cetyltrimethylammonium bromide (CTAB) protocol (Sramkó et al., 2014) using leaf material dried in silica gel. The Nextera Library Preparation Kit (Illumina, San Diego, California, USA) was used to construct the library from the equimolar mix of DNA from three individuals (Appendix 1) following the manufacturer's protocol. Paired-end reads 250 bp in length were obtained using an Illumina MiSeq system with MiSeq Reagent Kit version 2. Sequencing reads were analyzed by QDD version 3.1.2 (Meglécz et al., 2014) using default settings to detect microsatellites and design primers. From the 9111 sequences with successful primer design, the following criteria were used to select primer pairs for laboratory testing: (i) the sequence contained only pure microsatellites in the target region with at least eight repeats; (ii) did not contain repeats of (AT)n; (iii) the primer alignment score to the amplified sequence was lower than 6; (iv) primers were at least 10 bases away from the microsatellite motif; (v) consensus sequences are based at most on three reads; (vi) no transposable elements are detected by RepeatMasker version 1.317 (Smit et al., 2013–2015); and (vii) no BLAST hit to non-Viridiplantae sequences in GenBank.

In total, 222 potential loci were identified, out of which the first 44 were selected for initial screening. Specific PCR amplification of the 44 loci was tested on a DNA sample of one individual from the Turda Gorge population (Appendix 1), implementing a temperature gradient PCR protocol. The success of PCR was evaluated on a chilled 2% agarose gel. The PCR mixture contained 1× DreamTaq Green Buffer, 0.2 mM dNTP (each), 1 mg/mL bovine serum albumin, 0.5 μM of each primer, 0.05 units DreamTaq Green DNA Polymerase, and 2 ng of template DNA for a final volume of 10 μL (all PCR reagents were purchased from Thermo Scientific, Carlsbad, California, USA). The cycling regime of the PCR protocol was: 94°C for 3 min; 40 cycles of 15 s at 94°C, 30 s at 56°C–64°C, and 30 s at 72°C; with a final extension at 72°C for 14 min. After this step, 22 primer pairs (Table 1) remained that presented specific products at the same annealing temperature of 64°C. These loci were further tested for polymorphism at the population level on five individuals from the Pilis Hill population (Appendix 1). The same PCR mixture and evaluation method was used as described above. Cycling regime was also the same except setting annealing temperature to 64°C. Thirteen loci proved to be polymorphic at the population level based on visual inspection of the agarose gel. These loci were selected for further analysis, and their forward primers were labeled fluorescently at their 5′ end (Table 1). All 13 selected loci were PCR amplified using the PCR conditions described above.

Table 1. Characteristics of 22 microsatellite loci developed in Ferula sadleriana.
Locusa Primer sequences (5′–3′) Repeat motif Allele size range (bp) Fluorescent dye GenBank accession no.
FSad01d F: TGCGATGTTGAAGATAAACGGC (AG)13 240 MN603946
R: ATCGGCACCACTCACAGTAG
FSad03d F: ATCAACATCTATTATCAGTCATCCTTC (GA)17 140 MN603947
R: AAATGACCCTGATCGTTGAGG
FSad04d F: GTGAGCACTGGATACCGGAC (TG)9 94 MN603948
R: TCTGCTACCAACAGTCCTGG
FSad06b F: CCCGCATTACATTATTTGTAGTCG (GA)9 111–121 VIC MK393172
R: CGTCCTCGTCACCAGATAAGC
FSad07b F: AGGAGGTGTTGTTGACCCAG (GT)10 216–226 VIC MK393173
R: CCACTTCACAAATCTAAATTCCTACAC
FSad09c F: CTGTCGCCGGTGGTGATG (AG)9 193–249 6-FAM MK393174
R: CCACTGATCACTACAGCGCC
FSad10d F: GGAAGGATAAGAAATATCAATCGGACG (TG)13 151 MN603949
R: TGCTTTATTGCGGAGAAAGTTCC
FSad11c F: TGGTTCTCATTCGAGCACATG (AG)11 156–168 VIC MK393175
R: CTTCCTCCACTGACCGTGAG
FSad12b F: TGCCATGCATACTGTGTAACAC (CT)9 288–294 6-FAM MK393176
R: GCTCTTGATTCTCATCTGAAACAC
FSad13d F: CATCTGAGCGAGGCCGAC (GA)10 192 MN603950
R: TATCTCCTCTTCTTCGCCACC
FSad20d F: GCAATGGCTTCAATCGGTTC (TC)9 168 MN557388
R: ACCGCAATAGAAGCTCTAAGAGG
FSad25b F: AACGATGTCGCACTTCGGAC (CT)15 171–211 NED MK393177
R: CAACGGGAACAAATCATCAGCC
FSad26d F: ACCAGGTCCCACTCCCTTTC (TC)9 241 MN557389
R: AGAATTGTGAACATCAAAGACCC
FSad28d F: ATTTACCGGCGGTATGACCC (CT)10 135 MN603951
R: TGGTCGAAGCATGGTTGGAG
FSad32d F: AGACTATCCAGAGGACCGGC (GAA)9 240 MN603952
R: TTGTTCTGCCAGAGATCCCG
FSad33c F: TTTCTACCATCGCCATCTACCAC (CT)10 282–292 PET MK393178
R: AGAGTAAGTATCTCCAGATGTTCTTG
FSad36c F: AGTTGCCAAGATTTGTGTCTAGC (CA)10 135–143 NED MK393179
R: TGTGCCTTTGTACTGTAGTGG
FSad37b F: GACATAAGTTGGTTGAGTTAGTTAGG (CT)11 115–159 6-FAM MK393180
R: ACACTCTATTTGATGGAGTCACC
FSad39c F: ACACATAACCCAACGACTACGG (TC)10 228–240 NED MK393181
R: TGTTACCGTCTTCTCCGACC
FSad40c F: AGCGCAGGAATTGAATTGGC (AAG)10 129–147 6-FAM MK393182
R: TTCCCACCCATAGACTGCTG
FSad42b F: TCAGTCATCATCCTTTCCTTCTC (TC)9 134–160 PET MK393183
R: GACATGCTATGACCATCTGAATTC
FSad43c F: TGGCAAAGAGTCAGCAATGC (TAGA)9 182–234 PET MK393184
R: ACTAGGTGTACATGAAGACACGG
  • a Annealing temperature was 64°C for all primers.
  • b Included in Multiplex 1.
  • c Included in Multiplex 2.
  • d Monomorphic in our preliminary test and therefore omitted from further analyses.

Three populations (n = 16, 20, and 18) were used to test the applicability of these loci for population genetics (Table 2). The fluorescently labeled PCR products were analyzed on an ABI 3130 Genetic Analyzer (Applied Biosystems, Foster City, California, USA). Multiplexing was carried out equimolarly including six loci in each mix, according to their fragment length and label type (Table 1). One microliter of the multiplexed PCR products was added to 0.25 μL of GeneScan 500 LIZ Size Standard (Applied Biosystems) and 14.75 μL Hi-Di formamide (Genetic Analysis Grade, Applied Biosystems) before analysis. PeakScanner version 1.0 (Applied Biosystems) was used to carry out genotype calling manually.

Table 2. Genetic properties of the 13 polymorphic SSR markers developed in Ferula sadleriana.a
Locus Total (n = 54) Turda Gorge (n = 16) Pilis Hill (n = 20) Bélkő (n = 18)
A H o H t A A p Null H o H e A A p Null H o H e A A p Null H o H e
FSad06 6 0.519 0.786 5 0 0.083 0.500 0.621 5 0 0.193 0.400* 0.739 6 1 0.072 0.667 0.792
FSad37 10 0.283 0.808 7 4 0.352 0.133* 0.742 5 0 0.277 0.250* 0.738 5 1 0.176 0.444* 0.736
FSad42 5 0.407 0.503 4 1 0.000 0.563 0.584 2 0 0.000 0.100 0.095 4 1 0.011 0.611 0.631
FSad25 14 0.704 0.840 8 3 0.057 0.688 0.822 4 0 0.000 0.650 0.558 11 4 0.019 0.778 0.840
FSad07 5 0.444 0.732 5 1 0.000 0.750* 0.699 4 0 0.243 0.300* 0.716 4 0 0.119 0.333 0.539
FSad12 4 0.426 0.547 3 1 0.087 0.375 0.508 2 0 0.166 0.250 0.499 3 1 0.000 0.667 0.586
FSad36 3 0.352 0.339 3 1 0.000 0.250 0.225 2 0 0.000 0.400 0.375 2 0 0.000 0.389 0.375
FSad40 7 0.556 0.748 6 1 0.002 0.625 0.699 4 0 0.066 0.400 0.546 6 1 0.020 0.667 0.653
FSad11 7 0.593 0.752 7 1 0.006 0.813 0.797 5 0 0.000 0.600 0.611 3 0 0.081 0.389 0.468
FSad43 8 0.500 0.777 6 2 0.270 0.286* 0.763 5 0 0.080 0.550 0.700 5 1 0.000 0.611 0.583
FSad09 14 0.667 0.881 9 3 0.097 0.625* 0.813 7 1 0.035 0.800 0.823 10 2 0.170 0.556* 0.869
FSad39 6 0.704 0.737 6 0 0.000 0.938 0.779 4 0 0.000 0.700* 0.648 6 0 0.111 0.500* 0.698
FSad33 3 0.130 0.626 3 0 0.218 0.188* 0.529 2 0 0.300 0.050* 0.499 3 0 0.263 0.167* 0.586

Note

  • A = number of alleles; Ap = number of private alleles; He = expected heterozygosity; Ho = observed heterozygosity; Ht = expected heterozygosity among all populations; n = number of individuals.
  • a Locality and voucher information are provided in Appendix 1.
  • * Significant deviation from Hardy–Weinberg equilibrium at P < 0.05 level.

Here we report numbers of alleles and private alleles, and levels of expected and observed heterozygosity. Genotypes were analyzed with the software GenAlEx version 6.5 (Peakall and Smouse, 2012). Deviations from Hardy–Weinberg equilibrium (HWE) and measures of linkage disequilibrium among loci were calculated using GENEPOP version 4.2 (Raymond and Rousset, 1995; Rousset, 2008). Null alleles were assessed by FreeNA (Chapuis and Estoup, 2007). The Markov chain Monte Carlo parameters were left at default settings when used for the probability test of HWE. Allele numbers ranged from 3–14 across all populations, with an average number of private alleles of 1.4 (Turda Gorge population), 0.1 (Pilis Hill population), and 0.9 (Bélkő population). Expected heterozygosity values ranged from 0.095 to 0.869, observed heterozygosity values ranged between 0.05 and 0.938, and deviations from HWE were present in all three populations, most prevalent at loci FSad37 and FSad33 (Table 2). This pattern is likely the result of the presence of null alleles (Table 2) and requires adjustment of allele frequencies (Chapuis and Estoup, 2007). Linkage disequilibrium was observed between loci FSad12 and FSad33 (P = 0.001), FSad25 and FSad40 (P = 0.001), and FSad40 and FSad42 (P = 0.004) across all populations.

Cross-species amplification was tested in three populations of F. soongarica (n = 6) and three populations of F. tatarica (n = 4), both of which are close relatives of F. sadleriana. Using the same PCR conditions and a chilled 2% agarose gel, 20 and 19 of the 22 original loci amplified and presented a specific product, with apparent polymorphism in most loci, in F. soongarica and F. tatarica, respectively (Table 3).

Table 3. Cross-amplification success (showing allele size range in base pairs) of 22 microsatellite loci developed in Ferula sadleriana in closely related Ferula species.a
Locus Ferula soongarica (n = 6) Ferula tatarica (n = 4)
FSad01 256–290 228–284
FSad03 130–132 138–140
FSad04 113–116 117
FSad06 139–154 137–151
FSad07 212–254 212–233
FSad09 201–230 202–255
FSad10 180 179–186
FSad11 169–186 173–189
FSad12 300–319 286–337
FSad13 206–211 203–207
FSad20 172–179
FSad25 200–243 194–221
FSad26 217–238 216–227
FSad28
FSad32
FSad33 279–310 290–322
FSad36 137–145 138–140
FSad37 137–165 141–177
FSad39 221–251 231–249
FSad40 199–206 201–205
FSad42 190–203 193–228
FSad43 157 192–217

Note

  • — = unsuccessful amplification; n = number of individuals.
  • a Locality and voucher information are provided in Appendix 1.

CONCLUSIONS

We developed 22 SSR markers in F. sadleriana, out of which 13 proved to be polymorphic in the studied populations. As the first genetic markers developed for this endangered species, they represent key tools in the population genetics and therefore conservation biology of these plants. Most markers provided specific products in two congeneric species, suggesting their wider applicability in the genus, which is currently completely lacking such markers.

ACKNOWLEDGMENTS

The authors thank Viktor Virók, József Nagy, Lajos Somlyay, József Sulyok, and Róbert Šuvada for assistance in the field, and Shyryn Almerekova, Máté Déri, Réka Durakov, and Virág Krízsik for assistance in the lab. Support was received by the ÚNKP-19-3 New National Excellence Program of the Ministry for Innovation and Technology (to T.M.), the Swiss National Science Foundation (PSZ 131726, 160004, 131726; to P.S.), and the Bükk National Park Directorate (Eger, Hungary).

    Appendix 1: Geographic and voucher information of Ferula populations represented in this study.

    Species N Location, ISO country code Geographic coordinates Vouchera
    Ferula sadleriana 20 Pilis Hill, HUb,d 47°40′51.17″N, 18°52′47.28″E DE-Soo-45690
    Ferula sadleriana 18 Pisznice, HUb 47°41′59.06″N, 18°29′27.49″E DE-Soo-45689
    Ferula sadleriana 10 Konyári plateau, SKb 48°34′29.35″N, 20°23′09.96″E DE-Soo-45687
    Ferula sadleriana 16 Turda Gorge, ROc 46°33′31.27″N, 23°40′56.32″E DE-Soo-45691
    Ferula sadleriana 18 Bélkő Hill, HU 48°02′33.40″N, 20°22′32.20″E DE-Soo-48196
    Ferula soongarica 3 Katon-Karagay, KZ 49°13′14.66″N, 85°46′55.45″E DE-Soo-45033
    Ferula soongarica 2 Markakol: Uspenka, KZ 48°30′11.92″N, 85°53′16.15″E DE-Soo-45692
    Ferula soongarica 1 Ust’-Kamenogorsk, KZ 50°02′51.72″N, 81°23′19.39″E DE-Soo-45028
    Ferula tatarica 2 Strilcovskaya steppe, UA 49°17′03.87″N, 40°02′04.73″E DE-Soo-45688
    Ferula tatarica 1 Kalach-na-Donu, RS 48°41′16.44″N, 43°27′13.03″E DE-Soo-45038
    Ferula tatarica 1 Danilovka valley, RS 50°34′24.40″N, 45°39′36.05″E DE-Soo-45037
    Note
    • ISO = International Organization for Standardization; N = number of individuals sampled.
    • a Voucher specimens are deposited at the herbarium of the University of Debrecen (DE), Debrecen, Hungary.
    • b One individual from this population was used to construct the initial Nextera primer development library.
    • c Specific amplification of all 44 primers designed was tested on one individual of this population.
    • d Population-level variability of specific primers was screened on five individuals of this population.

    DATA AVAILABILITY

    Raw sequencing reads were deposited in the European Nucleotide Archive (ENA) under the study accession number PRJEB35561 (“Ferula sadleriana microsatellite discovery”). Sequence information for the primers described here has been deposited in the National Center for Biotechnology Information's GenBank database, and accession numbers are provided in Table 1.