Microsatellite markers for population studies of Phytophthora megakarya (Pythiaceae), a cacao pathogen in Africa†
Freely available online through the AJB open access option.
The authors thank CIRAD and the AIP BioRessources EcoMicro for financial support. We are indebted to Eric Rosenquist and Eileen Herrera from the USDA who have funded the main sampling steps. Many thanks to Salomon Nyasse (IRAD), Gary Samuels (ARS-USDA), and Kelly Ivors (North Carolina State University) for their support. Genotyping was realized on the IFR119 “Montpellier Environnement Biodiversité” platform.
Abstract
• Premise of the study: Phytophthora megakarya is the agent of black pod disease of cacao and is the main pathogen of this crop in Africa. Population genetic studies are required to investigate how this pathogen emerged. To this end, we developed 12 novel polymorphic microsatellite markers for P. megakarya.
• Methods and Results: Microsatellite sequences were obtained by pyrosequencing of multiplex-enriched libraries. Candidate loci with di- or trinucleotide motifs were selected, and primer pairs were tested with nine P. megakarya isolates. The 12 most polymorphic and unambiguous loci were selected to develop three multiplex PCR pools. The total number of alleles varied from two to nine, depending on loci, and higher than expected heterozygosity was observed.
• Conclusions: These markers were used for population genetic studies of P. megakarya in Cameroon and for comparison with reference strains from West Africa. This is the first time that microsatellite markers have been developed for P. megakarya.
Phytophthora megakarya Brassier & Griffin, the causal agent of black pod disease, is now the most important cacao pathogen in Central and West Africa (4). Losses are reported to be as high as 80% of potential yield in Cameroon, and can reach 100% in Ghana. Although cacao was introduced in Africa from South America, P. megakarya is a diploid species endemic to Equatorial Guinea, Gabon, Cameroon, Nigeria, Togo, and Ghana (4). Its purported center of diversity, based on evidence from molecular and mating type studies, lies on the border between Nigeria and Cameroon (9). The pathogen is still in an invasive phase in Ivory Coast, the first cacao-producing country, where it is replacing the more widespread but less aggressive P. palmivora (Butler) Butler (4). Identifying the origin and the phylogeny of this diploid pathogen would provide useful insights to epidemiologists and breeders, and help in the development of integrated control strategies and management of the disease. The first step is a thorough evaluation of the current genetic diversity of P. megakarya, and a better understanding of the population structure.
In the current study, we developed 12 novel microsatellite markers for P. megakarya. These markers were used to characterize 652 P. megakarya isolates collected in cacao plantations from Central and West Africa. Because cross amplification of microsatellite markers occurs between related Phytophthora species (5), we tested cross amplification in 15 P. palmivora individuals, an ubiquist and important cacao pathogen belonging to the same phylogenetic clade as P. megakarya.
METHODS AND RESULTS
The P. megakarya reference isolate NS269 collected in the Fako region in Cameroon was used for the detection of microsatellites. NS269 belongs to an intermediate genetic group between Central and West African groups (9). The method consisted of a biotin-enriched protocol adapted from 7 at Genoscreen (Lille, France), and developed within the AIP BioRessources EcoMicro Project. DNA was extracted using a standard phenol-chloroform protocol previously defined (1), digested with RsaI (Fermentas, Burlington, Ontario, Canada), and ligated to standard oligonucleotide adapters (3). The ligated DNA was hybridized to biotin-labeled oligonucleotides and the enrichment step was completed using magnetic beads (Invitrogen, Carlsbad, California, USA); the enriched DNA was amplified using primers corresponding to the adapters (3; 8). The PCR product was purified using a purification kit (QIAGEN, Hilden, Germany), and the enriched library was used in the 454 GS-FLX Titanium library preparation (Roche Applied Science, Indianapolis, Indiana, USA). Primers were designed using QDD software (8).
From the 13705 raw sequences obtained, 2234 were longer than 80 bp, with more than four repeats for any microsatellite motif from two to six nucleotides. Potential intragenomic multicopies (duplicated loci or transposable elements, with BLAST hits to other sequences) were discarded. Sequences with the following characteristics were selected to design primers: (1) containing microsatellite tandems longer than four repeats, and (2) with flanking regions with less than one four-base mononucleotide stretch or two repeats of any di-hexa base-pair motif (3). Primers were designed using the following criteria: PCR product size between 80 and 300 bp, annealing temperature (Ta) between 57°C and 60°C. A total of 677 microsatellite loci (mostly di- and trinucleotides) matched the QDD quality criteria, and primer design was successful for 465 loci. Among them, 362 had perfect motifs and 103 had compound ones, with a number of repeats ranging from four to eight.
We randomly selected 110 loci (56 perfect loci and 44 compound loci) for a preliminary polymorphism screening with 11 individuals on 3% agarose gel. The set was made of nine P. megakarya isolates: NS359, NS468, M309, MC19, MC25, and the reference NS269 (all from Cameroon and of mating type A1), M184 (Cameroon, A2), NGR16 (Nigeria, A2), and NGR20 (Nigeria, A1); and two P. palmivora from Trinidad (Tri1) and Jamaica (P881), to test for cross-species amplification (Appendix 1). PCR conditions were as follows: initial denaturation at 95°C for 15 min followed by 40 cycles of 94°C for 30 s, 60°C for 1 min 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. Reactions were run in a PTC200 thermocycler (MJ Research, Waltham, Massachusetts, USA). Among these 110 loci, only 20 exhibited expected patterns, and had single amplification product, variable in size; these were retained for further analyses. Forward primers were labeled at the 5′ end with fluorescent tags 6-FAM, PET, NED, or VIC (Applied Biosystems, Carlsbad, California, USA). PCR was performed for individual tagged primer pairs (simplex). The 10-μL reaction mixture consisted of 3 μL DNA (10 ng μL−1), 5 μL 2× QIAGEN Multiplex Master Mix, 1 μL 5× Q-Solution, and 0.5 μL forward and reverse primers. Amplification conditions were the same but defined melting temperatures (Tm) were used for primers. The PCR amplicons were diluted 100-fold and sized by electrophoresis on an ABI Prism 3130xl 16 Capillary Sequencer (Applied Biosystems), using the GeneScan 400(−250) LIZ size standard and GeneMapper software version 4.0 (Applied Biosystems).
The 12 most informative loci (clear profiles with polymorphism), given in Table 1, were selected for microsatellite analysis of 652 isolates from Central and West Africa. All the isolates used in this study are conserved at the CIRAD Biologie et Génétique des Interactions Plant-Parasite (BGPI) unit, Montpellier, France. The protocol was optimized in terms of primer concentration and PCR product dilution. All the primer pairs were finally combined into three easy-to-score multiplex panels of four microsatellites each (Table 1). Genetic data were analyzed using GENETIX 4.02 (2). Linkage disequilibrium between pairs of loci was determined using GENEPOP 4.0 (10).
| Locus name | GenBank EMBL accession ID | Repeat motif | Primer sequences (5′–3′) | Fluorescent tag | Multiplex panel | Ta (°C) | Expected size (bp)a | Observed size range (bp) |
|---|---|---|---|---|---|---|---|---|
| SSR1 | FR750981 | (TTG)7 | F: TACGATCACAGACCATTCCG | VIC | 2 | 60 | 124 | 117–123 |
| R: TGTAGCCACAATGCCACAAT | ||||||||
| SSR6b | FR750982 | (GA)2A(GT)7 | F: CGTGAGGAAATTCTCAAGGC | PET | 1 | 60 | 83 | 78–86 |
| R: CAGATCTCGCCAACAACAGA | ||||||||
| SSR7 | FR750983 | (GA)7 | F: CGCCACCTCTTTCTTCTTTG | PET | 2 | 60 | 252 | 250–258 |
| R: TGTGCAAGTTTCTCCACACC | ||||||||
| SSR8 | FR750984 | (GAA)7 | F: CTTTCCGTGGAGATCCTGAG | PET | 3 | 62 | 84 | 71–104 |
| R: ATGCCAACGAAGATTCATCC | ||||||||
| SSR11 | FR750985 | (CTT)7 | F: ACTCTTTTTCCGTTTGGGCT | VIC | 3 | 58 | 133 | 122–134 |
| R: GGACGAACAACAGAAGGAGC | ||||||||
| SSR20 | FR750986 | (GAA)6 | F: CTTTGCATTCCTCGCAGACT | NED | 2 | 60 | 93 | 87–99 |
| R: TCAGGAATCACCACCTCCTC | ||||||||
| SSR22 | FR750987 | (GT)6 | F: GGCTGTCTGATATGGGTGGT | PET | 3 | 62 | 156 | 158–162 |
| R: AACATCCCGTCGACACCTAC | ||||||||
| SSR24 | FR750988 | (CGT)6 | F: GTGGAAACAGAAGCTGCACA | NED | 1 | 60 | 188 | 180–189 |
| R: CCGGTCACTACCAAACGAAC | ||||||||
| SSR28b | FR750989 | (TGA)2(GA)6 | F: ACTTGATCTGGTGGACGGAT | VIC | 1 | 60 | 230 | 221–227 |
| R: GCATGGCTATGGACGAAAAT | ||||||||
| SSR31 | FR750990 | (CCT)4 | F: ATGACGGAGTTGCGAGCTAA | 6-FAM | 1 | 60 | 88 | 82–85 |
| R: GGTTTGTCGAGCTGATGGAT | ||||||||
| SSR49 | FR750991 | (TTG)4 | F: CTTCGGCCATGTAGGTTTGT | 6-FAM | 2 | 60 | 234 | 239–245 |
| R: CATGCACGCTTGACTCTCAT | ||||||||
| SSR71b | FR750992 | (CTA)4G(TA)2 | F: TGGAAGATGGTTCTTTACAGC | 6-FAM | 3 | 60 | 205 | 201–207 |
| R: ACCGGAACAGTGGGTGTTAC | ||||||||
| SSR23 | HE804168 | (GATA)5 | F: TCCAAGCGGACGAAAACTAC | VIC | 60 | 126 | 120 | |
| R: TCAATTGTGGCTTCAACGTC | ||||||||
| SSR36 | HE804169 | (GAT)4 | F: GACAGTCGACAAATAGCGCA | PET | 60 | 82 | 85 | |
| R: TAACGGTGATCGCATTGAAA | ||||||||
| SSR38 | HE804170 | (TCG)5 | F: AGGTCCTGTTTCCTCGGTTT | VIC | 60 | 129 | 131 | |
| R: CTCTATCTCGGACGGCTACG | ||||||||
| SSR39 | HE804171 | (AAT)4 | F: CACGATCCCGAAAATAGCAT | PET | 58 | 89 | 91 | |
| R: TGACATTGTATTGCCCATCG | ||||||||
| SSR41 | HE804172 | (GTT)5 | F: CTTCTTCCTCACCTTCGTGC | NED | 62 | 110 | 109 | |
| R: GGCACTACTTTGCCATTGGT | ||||||||
| SSR42 | HE804173 | (AAG)5 | F: CAAATGCTGCGTCCACAATA | NED | 58 | 96 | 93 | |
| R: GTCGTTCAGGACTGGGTGAT | ||||||||
| SSR50 | HE804174 | (CGA)4 | F: TGGATTTCGTCCTCTGCTTC | 6-FAM | 60 | 236 | 244–267 | |
| R: ATGCTGGCCAAACAGGTATC | ||||||||
| SSR52 | HE804175 | (CTT)4 | F: GAATTCGTCGGACATTCGTC | 6-FAM | 60 | 232 | 230 | |
| R: TGTTTACCTTGCGTGCGTAG |
- Note: F = forward primer; R = reverse primer; Ta = mean annealing temperature for primer pairs.
- a Expected size deduced from the sequence of the locus in the reference strain NS269.
- b Compound loci.
The number of alleles per locus ranged from two to nine, with an average of 5.25 over 652 isolates from Central and West Africa (Table 2), and the observed genotypes were consistent with diploidy. Across all populations, observed heterozygosity (Ho) calculated for each locus varied from 0.150 to 0.985 (mean: 0.575), while expected heterozygosity (He), which provides a measurement of unbiased gene diversity at Hardy–Weinberg equilibrium, ranged from 0.241 to 0.725 (mean: 0.492). Among the 66 pairwise comparisons of loci, 55 exhibited highly significant linkage disequilibrium (Fisher's exact test), consistent with a clonal reproduction of P. megakarya as reported for other Phytophthora species (6). All the P. palmivora isolates cross-amplified at the 12 loci.
| Cameroon (N = 597)a | Central Africa (N = 15)a | West Africa (N = 40)a | |||||||
|---|---|---|---|---|---|---|---|---|---|
| Locus name | A | Ho | He | A | Ho | He | A | Ho | He |
| SSR1 | 2 | 0.149 | 0.179 | 1 | 0.000 | 0.000 | 3 | 0.225 | 0.204 |
| SSR6* | 4 | 0.147 | 0.162 | 3 | 0.067 | 0.127 | 5 | 0.825 | 0.636 |
| SSR7* | 4 | 0.956 | 0.637 | 3 | 1.000 | 0.647 | 2 | 0.025 | 0.240 |
| SSR8* | 8 | 0.985 | 0.624 | 4 | 0.933 | 0.684 | 4 | 1.000 | 0.602 |
| SSR11* | 6 | 0.477 | 0.368 | 2 | 0.800 | 0.551 | 4 | 0.600 | 0.440 |
| SSR20 | 6 | 0.647 | 0.729 | 3 | 1.000 | 0.531 | 5 | 0.200 | 0.249 |
| SSR22 | 4 | 0.409 | 0.514 | 3 | 0.933 | 0.613 | 2 | 0.525 | 0.410 |
| SSR24* | 3 | 0.915 | 0.559 | 3 | 1.000 | 0.620 | 3 | 0.325 | 0.549 |
| SSR28* | 3 | 0.722 | 0.515 | 2 | 0.333 | 0.278 | 4 | 0.950 | 0.558 |
| SSR31* | 3 | 0.965 | 0.507 | 2 | 1.000 | 0.500 | 2 | 1.000 | 0.500 |
| SSR49 | 2 | 0.380 | 0.391 | 2 | 0.933 | 0.498 | 2 | 0.050 | 0.049 |
| SSR71 | 4 | 0.196 | 0.421 | 2 | 0.333 | 0.380 | 2 | 0.250 | 0.335 |
- Note: A = number of alleles; He = expected heterozygosity; Ho = mean observed heterozygosity; N = size of the sample analyzed.
- *Locus exhibiting a deviation from HWE in the whole population.
- a Cameroon (Centre, South, East, and Southwest); Central Africa (Gabon, São Tomé); West Africa (Nigeria, Togo, Ghana, Côte d'Ivoire).
CONCLUSIONS
A significant excess of heterozygosity was detected in most of the loci within the three populations studied (Cameroon, Central Africa, West Africa). Higher-than-expected heterozygosity and significant linkage disequilibrium suggested a clonal mode of reproduction. The results showed the occurrence of cross amplification between P. palmivora and P. megakarya, a feature that has already been observed for other Phytophthora species within the same clade. The microsatellite markers developed here constitute a useful tool for investigating the genetic structure and evolutionary history of this pathogen. These studies will help in setting control strategies against black pod disease.
Appendix 1
Isolates included in the preliminary study.
| Isolate | Species | Mating type | Country of origin | Region | Year | Geographical coordinates |
|---|---|---|---|---|---|---|
| NS359 | P. megakarya | A1 | Cameroon | Southwest | 1996 | 4°38.226′N, 9°28.248′E |
| NS468 | P. megakarya | A1 | Cameroon | Southwest | 1997 | 4°38.226′N, 9°28.248′E |
| M309 | P. megakarya | A1 | Cameroon | Southwest | 1998 | 4°38.226′N, 9°28.248′E |
| MC19 | P. megakarya | A1 | Cameroon | Centre | 2007 | 3°16.324′N, 11°13.111′E |
| MC25 | P. megakarya | A1 | Cameroon | Centre | 2007 | 3°16.324′N, 11°13.111′E |
| NS269 | P. megakarya | A1 | Cameroon | Southwest | 1995 | 4°04.003′N, 9°01.597′E |
| M184 | P. megakarya | A2 | Cameroon | Centre | 1987 | 3°51.393′N, 11°27.197′E |
| NGR16 | P. megakarya | A2 | Nigeria | NA | 1995 | 7°08.772′N, 4°83.776′E |
| NGR20 | P. megakarya | A1 | Nigeria | NA | NA | 7°17.600′N, 5°11.667′E |
| Tri1 | P. palmivora | A2 | Trinidad & Tobago | NA | NA | NA |
| P881 | P. palmivora | A1 | Jamaica | NA | NA | NA |
- Note: NA = not available.
